جبران تغذیه آغوز گوساله

جبران تغذیه آغوز گوساله با تیوب کلستروم، پروبیوتیک و مخمر !

1. آیا تیوپ آغوز، پروبیوتیک ها (باکتری ها) و مخمرها می توانند تغذیه آغوز را جبران کنند؟

معرفی شما از جبران تغذیه آغوز گوساله چیست؟

من این سوال را اینگونه مطرح میکنم که آیا اصلا امکان جبران تغذیه آغوز گوساله با تیوب کلستروم، پروبیوتیک و مخمر وجود دارد؟ نرخ بالای مرگ و میر گوساله های نوزادی – تقریباً 7.8٪ از تلیسه های از شیر گرفته شده در سرتاسر آمریکای شمالی (USDA، 2010) – یک چالش طولانی مدت برای صنعت لبنیات باقی مانده است.

نظر شما در خصوص اثربخشی تیوب کلستروم، پروبیوتیک و مخمر به عنوان جایگزین آغوز چیست؟

  1. مصرف تیوب کلستروم باعث افزایش ایمنی روده گوساله میشود.
  2. پروبیوتیک هایی نظیر  لاکتوباسیلوس علاوه بر تاثیرگذاری بر ایمنی روده ، باعث کاهش میزان پاتوژن های روده میشوند.
  3. پیشنهاد من در خصوص  گوساله هایی که به هر علت در زمان طلایی امکان تغذیه با آغوز را نداشتند ، استفاده از مخمرهاست زیرا می توانند باعث تحریک رشد سیستم ایمنی گردند.

حتی اگر گوساله ها از نظر سلامتی در شرایط مطلوبی هستند می توانیم با این روش ها گوساله ها را آماده مصرف استارتر بیشتر و از شیرگیری نماییم. اما باید از کیفیت محصولاتی که با این عناوین در بازار هستند اطمینان حاصل کنیم تا تاثیرگذاری مناسب را مشاهده کنیم.

عوارض عدم مصرف آغوز در زمان طلایی چه میتواند باشد؟

عفونت های گوارشی و اسهال و کم آبی متعاقب آن بیشتر مرگ و میر و عوارض گوساله های نوزاد را تشکیل می دهند

راه حل پیشنهادی شما برای به حداقل رساندن ضرر ناشی از دست دادن زمان طلایی تغذیه آغوز گوساله چیست؟

تلاش کنید حداقل طی ۱۲ ساعت اول آغوز به گوساله خورانده شود تا ایمونوگلوبولین های مورد نیاز در اختیار گوساله قرار بگیرد.

ارجحیت شما باید شیر انتقالی باشد و نه شیر عادی (منظور از شیر انتقالی، شیری است که پس از آغوز، در روز ۳-۲ پس از زایمان و پیش از رسیدن به تولید عادی گاو تولید می شود)

از بین استانداردهای تغذیه با آغوز ، مقدار ، کیفیت و زمان آغوز، 3 آیتم تاثیر گذار بر تغذیه سالم گوساله تازه زا هستند…..(ادامه مطلب)

در امریکا شیوه های متداول درمان اسهال گوساله چیست؟

  1. شیوه های متداول استفاده شده توسط تولیدکنندگان برای درمان اسهال شامل الکترولیت درمانی برای جایگزینی مایعات از دست رفته یا تجویز آنتی بیوتیک ها برای مبارزه با عوامل بیماری زا مهاجم است.
  2. با این حال، استفاده گسترده از آنتی بیوتیک ها ممکن است منجر به پاتوژن های مقاوم به آنتی بیوتیک شود که خطر بالقوه قرار گرفتن در معرض گوساله ها و انسان ها را به همراه دارد.
  3. جایگزین های آنتی بیوتیک برای پیشگیری و درمان اسهال مطلوب است.

استفاده از پروبیوتیکها در تغذیه جبرانی آغوز گوساله ، را چگونه ارزیابی میکنید؟

پروبیوتیک‌ها، از جمله باکتری‌های زنده و مخمرها، مکمل‌های غذایی میکروبی هستند که:

  1. ممکن است با بهبود تعادل میکروبی روده میزبان، تأثیر مفیدی بر میزبان بگذارند و
  2. به طور گسترده به عنوان تقویت‌کننده تولید مورد مطالعه قرار گرفته‌اند .

مطالعات اخیر در تک معده نشان داده است که تغذیه ساکارومایسس سرویزیه var boulardii (SCB)، زیرگروه گونه‌های ساکارومایسس سرویزیه (SC)، می‌تواند :

  1. خطر ابتلا به بیماری‌های روده را با مهار رشد برخی از سموم کاهش دهد.
  2.  محل‌های گیرنده‌های سمی بیماری‌زا، مسدود میکند
  3. گیرنده‌های سمی بیماری‌زا،را تخریب  میکند

 

در بدو تولد، سیستم گوارش گوساله مشابه حیوانات تک معده ای عمل می کند (دراکلی، 2008). به دلیل این شباهت، ما فرض کردیم که تغذیه SCB اثرات مشابهی در گوساله ها دارد و در نتیجه سلامت و رشد دستگاه گوارش آنها را بهبود می بخشد. هدف از این مطالعه بررسی اثرات مکمل SCB در جایگزین شیر (MR) در دوره قبل از شیرگیری بر مصرف، رشد و سلامت گوساله ها بود.

علاوه بر این، به دلیل این مفهوم رو به رشد که ایجاد یک جمعیت میکرو فلور مناسب در روده می تواند در برابر عفونت های بیماری زا دفاع کند (ویلیامز، 2010) و استعمار اولیه باکتری ها ممکن است بر رشد و نمو حیوانات در مراحل بعدی زندگی تأثیر بگذارد (Malmuthuge et al., 2015).

هدف دوم ما ارزیابی این بود که آیا میکرو فلور روده تحت تأثیر مکمل SCB قرار گرفته است یا خیر.

در خصوص تاثیر محصولات پروبیوتیک در گاو شیری چه نظری دارید؟

در سطح جهانی، استفاده از پروبیوتیک ها به عنوان جایگزینی برای آنتی بیوتیک ها در کشاورزی به دلیل افزایش نگرانی ها در مورد مقاومت آنتی بیوتیکی افزایش یافته است .

انواع گونه های میکروبی مانند Bacillus spp.، Enterococcus spp. و مخمر ساکارومایسس (Simon et al., 2001)، در دام به عنوان محصولات پروبیوتیک استفاده میشوند.

استفاده از ساکارومایسس سرویزیه در تغذیه گاو شیری روز به روز محبوبیت بیشتری پیدا می کند. در چند سال اخیر، چندین شرکت تغذیه لبنی، سویه‌های مختلف ساکارومایسس سرویزیه را برای استفاده در تغذیه نشخوارکنندگان به صورت تجاری روانه بازار کرده‌اند.

جبران تغذیه آغوز گوساله
جبران تغذیه آغوز گوساله
جبران تغذیه آغوز گوساله
جبران تغذیه آغوز گوساله

 

اثر کوانتومی مکمل مخمر به عوامل زیادی مانند :

  1. ترکیب جیره،
  2. نسبت علوفه به کنسانتره،
  3. نوع علوفه تغذیه شده،
  4. دوز مخمر،
  5. استراتژی تغذیه و مرحله شیردهی بستگی دارد.

به نظر می رسد توانایی سویه های مختلف ساکارومایسس سرویزیه برای تحریک تعداد زنده باکتری ها در شکمبه با توانایی آنها در حذف اکسیژن از مایع شکمبه مرتبط باشد زیرا جهش یافته های بی هوازی ساکارومایسس سرویزیه قادر به تحریک تعداد باکتری ها نبودند.

آیا تاکنون مطالعه ایی در خصوص اثربخشی محصول مخمر بر عملکرد رشد گوساله شیری انجام شده است؟

بله. ما یک تحقیق جامع به بررسی اثرات مکمل یک  محصول مخمر ساکارومایسس بر عملکرد رشد گوساله شیری و پتانسیل آن در بهبود سلامت دام پرداخته ایم. عدم تأثیر درمان بر دریافت و عملکرد در این مطالعه با Quigley و همکاران همخوانی داشت.  هیچ تفاوتی در مصرف خوراک یا افزایش وزن بدن گوساله‌های تغذیه شده با محصول کشت مخمر مکمل‌شده در خوراک آغازین مشاهده نکرد.

پژوهش کمیته سیاست و رفاه حیوانات دانشکده در دانشگاه آلبرتا، ادمونتون، کاناداجهت مطالعه لطفا کلیک فرمایید

 

پنج نشانگر میکروبی کلی مرتبط با رشد و سلامت حیوانات، از جمله :اشریشیا کلی (E. coli؛ Muktar et al., 2015)، Clostridium cluster XIVa (Lopetuso et al., 2013)، Faecalibacterium prausnitzii (Uyeno et al., 2010) و Bifidobacterium spp. (پیکارد و همکاران، 2005) جمعیت آنها در مدفوع ارزیابی شدند.

2. مواد و روش ها

2.1. گاو شیری و رژیم های غذایی

این مطالعه توسط کمیته سیاست و رفاه حیوانات دانشکده در دانشگاه آلبرتا، ادمونتون، کانادا تایید شد و مطابق با دستورالعمل‌های شورای کانادایی مراقبت از گاو شیری(CCAC، 2009) در دامداری گاو شیری Eckerlea Acres در Seaforth انجام شد.

انتاریو، کانادا چهل و دو گوساله نر هلشتاین، با میانگین وزنی 0.77 ± 42.6 کیلوگرم در هنگام تولد، استفاده شد. گوساله‌ها در عرض 2 ساعت پس از تولد از گله خارج شدند، تگ شماره گوش دریافت کردند، وزن شدند و در جایگاه جداگانه با بستر مناسب قرار گرفتند.

به گوساله‌ها 4 لیتر آغوز با کیفیت (بیش از 50 میلی‌گرم بر میلی‌لیتر ایمونوگلوبولین G) ظرف 3 ساعت پس از تولد و 3 لیتر دیگر آغوز تازه در زمان تغذیه بعدی داده شد.

پس از تغذیه دوم با آغوز، گوساله ها به طور تصادفی به 1 از 2 تیمار غذایی تقسیم شدند:

  1. کنترل: یک تیمار تغذیه شده با MR تجاری.
  2. درمان: یک MR تجاری تغذیه شده با 5 گرم محصول زنده SCB در روز که انتظار می رفت روزانه 10 میلیارد واحد SCB برای هر گوساله تغذیه شود.

محصول SCB (ProTernative® Milk؛ Levucell SB20 حاوی سویه SCB Institute Pasteur CNCM I-1079؛ Lallemand Animal Nutrition، مونترال، کبک، کانادا) روزانه قبل از تغذیه صبح برای هر گوساله در یک سطل با MR مخلوط شد و به آنها داده شد. در اولین تغذیه روز همه گوساله‌ها در هفته اول زندگی با محلول MR توسط یک بطری نوک پستان (Super Calf Nipple؛ Merrick’s, Middleton, Wisconsin, USA) تغذیه شدند و سپس در 3 ± 7 روز به یک پستانک مصنوعی روی دروازه منتقل شدند (Peach Teats; Skellerup Industries Ltd.، Woolston، نیوزلند).

تنظیم تغذیه پستانک مصنوعی شامل سرپستانک نصب شده در جلوی جایگاه، متصل به یک لوله مجهز به دریچه یک طرفه بود که در یک سطل 8 لیتری قرار گرفته در خارج از جایگاه قرار می گرفت. MR مورد استفاده در این مطالعه حاوی 260 گرم بر کیلوگرم پروتئین خام، 160 گرم بر کیلوگرم چربی خام و 4.58 میکروکالری در کیلوگرم انرژی قابل سوخت و ساز (ME) بر اساس ماده خشک (DM) بود (MapleviewAgri، Palmerston، Ontario، کانادا)، و تا 150 گرم در لیتر با آب 40 درجه سانتی گراد مخلوط شدند. برای 2 روز اول، MR 3 بار در روز (0700، 1600 و 2100 ساعت) با 3 لیتر در هر 2 تغذیه اول و 2 لیتر در تغذیه سوم تغذیه شد.

از روز 3 تا از شیر گرفتن در روز 42، MR در 2 حجم مساوی روزانه در ساعت 0700 و 1600، با 8 لیتر روزانه از روز 3 تا 34، و 4 لیتر در روز از روز 35 تا 42 تغذیه شد. گوساله ها نیز گوساله به صورت آزاد دریافت کردند. استارتر حاوی 220 گرم بر کیلوگرم پروتئین خام، 37 گرم بر کیلوگرم چربی خام، 57 گرم بر کیلوگرم فیبر خام و 2.63 میکروکالری در کیلوگرم ME بر اساس DM (Nieuwland Feeds Elora Ltd., Elora, Ontario, Canada) از روز 7 سالگی . آنها همچنین در طول آزمایش به آب دسترسی آزاد داشتند.

  1. به گوساله ها بولوس First Defense (Immucell، پورتلند، مین، ایالات متحده آمریکا) و ویتامین E/سلنیوم دیستوسل (Zoetis، Kirkland، Quebec، کانادا) برای محافظت در برابر E. coli K99+ و ویروس کرونا و جلوگیری از بیماری عضله سفید پس از تولد به ترتیب داده شد.
  2. گوساله ها در برابر ویروس سنسیتیال تنفسی گاوی در روز اول با استفاده از Inforce 3 (Zoetis، Kirkland، Quebec، کانادا) واکسینه شدند.
  3. دراکسسین (تولاترومایسین؛ زوئتیس، کرکلند، کبک، کانادا) به عنوان پیشگیری کننده برای بیماری تنفسی گاو در روز 5 سالگی تجویز شد.

گوساله‌های مبتلا به اسهال که نیاز به درمان داشتند، متاکم (Boehringer Ingelheim Ltd.، برلینگتون، انتاریو، کانادا) را به صورت زیر جلدی و 2 تا 4 لیتر مایعات الکترولیت خوراکی در عصر بعد از ساعت 9 شب دریافت کردند. هر گوساله ای که مشکلات گوارشی و تنفسی داشت نیز تحت درمان قرار گرفت و برای مدت آن که 56 روز بود در مطالعه باقی ماند.

2.2. مصرف خوراک، رشد حیوانات، اندازه گیری های بهداشتی و جمع آوری نمونه

  1. استارتر گوساله ارائه شده و اورت ها روزانه تا 56 روزگی وزن و ثبت شدند تا میزان مصرف خوراک روزانه تعیین شود.
  2. گوساله ها در بدو تولد و پس از آن به صورت هفتگی تا هفته 8 وزن شدند تا میانگین افزایش روزانه هفتگی (ADG) تعیین شود.
  3. نمرات مدفوع، نمرات بینی و گوش هر روز قبل از تغذیه صبح با استفاده از مقیاس 0-3 (نمره مدفوع و نمره بینی) یا 0-4 (نمره گوش) که توسط دانشگاه ویسکانسین-مدیسون (McGuirk، 2008) تهیه شده بود، ثبت می شد.
  4. امتیاز مدفوع 0: نرمال، 1: نیمه شکل، 2: شل و 3: آبکی بود، با نمره مدفوع ≥ 2 به عنوان اسهال در نظر گرفته شد.
  5. نمرات بینی به عنوان 0: بدون ترشح، 1: مقدار کمی ترشح کدر از یک سوراخ بینی، 2: ترشحات ابری از هر دو سوراخ بینی، و 3: ترشح بیش از حد ابری غلیظ از هر دو سوراخ بینی طبقه بندی شد.
  6. نمرات گوش به صورت 0: عادی، 1: آویزان یک گوش، 2: هر دو گوش کمی آویزان، 3: هر دو گوش مستقیم به سمت پایین و 4: کج شدن سر دسته بندی شدند.
  7. نمونه‌های خون از طریق رگ‌گیری ژوگولار از گوساله‌ها در لوله‌های خلاء 24 ساعت پس از تجویز آغوز جمع‌آوری شد.
  8. پس از لخته شدن، نمونه‌ها در 3000 × گرم به مدت 10 دقیقه سانتریفیوژ شدند
  9. سپس نمونه‌های سرم جمع‌آوری و در دمای 20- درجه سانتیگراد تا تجزیه و تحلیل نگهداری شدند.
  10. نمونه مدفوع در روزهای 7، 35 و 56 پس از اولین تغذیه آن روز با استفاده از دستکش استریل جمع آوری شد.
  11. برای تحریک اجابت مزاج، انگشتی را وارد مقعد ساق پا کردند. یک فنجان برای گرفتن مدفوع استفاده شد
  12. نمونه در دمای -20 درجه سانتیگراد نگهداری شد.

2.3. تعیین پروتئین کل سرم Serum total protein determination

غلظت پروتئین کل سرم (STP) با استفاده از یک رفرکتومتر جبران کننده دما (TS Meter؛ American Optical، Buffalo، NY، USA) تعیین شد.

2.4. تجزیه و تحلیل واکنش زنجیره ای پلیمراز در زمان واقعی اهداف باکتریایی مدفوع

  1. DNA کل نمونه های مدفوع با روش ضربان مکرر مهره به اضافه ستون (RBB + C) جدا شد
  2. کیفیت و کمیت DNA با استفاده از اسپکتروفتومتر NanoDrop 1000 (NanoDrop Technologies, Wilmington, DE, USA) اندازه‌گیری شد.
  3. سپس DNA کل تا غلظت نهایی 20 نانوگرم در میکرولیتر رقیق شد
  4. و تا زمان تجزیه و تحلیل در دمای 20- درجه سانتیگراد ذخیره شد.
  5. جمعیت کل باکتری ها، E. coli، Clostridium cluster XIVa، Faecalibacterium prausnitzii و Bifidobacterium spp. با استفاده از پرایمرهای خاص (جدول 1) و شیمی سبز SYBR (سریع مخلوط سبز SYBR®؛ Applied Biosystems, Foster City, CA, USA) با یک سیستم واکنش زنجیره ای پلیمراز بلادرنگ StepOne Plus (PCR) (Applied Biosystems, Foster) تخمین زده شد.
  6. شرایط بی‌درنگ PCR 95 درجه سانتی‌گراد برای 20 ثانیه (5 دقیقه برای کل باکتری‌ها)، پس از آن 40 چرخه در دمای 95 درجه سانتی‌گراد برای 3 ثانیه (20 ثانیه برای کل باکتری‌ها) و دمای بازپخت (مانند جدول 1) برای 30 ثانیه بود.

هر PCR (20 میکرولیتر) حاوی:

  1. 10 میکرولیتر SYBR Green، 1 میکرولیتر (0.5 میکرولیتر برای کل باکتری) از هر پرایمر (20 میلی‌مولار)،
  2. 1 میکرولیتر DNA الگو و 7 میکرولیتر (8 میکرولیتر برای کل باکتری) H2O استریل بود.
  3. سه تکرار از هر الگوی DNA استفاده شد،
  4. کنترل های منفی (آب مقطر استریل) نیز برای حذف آلودگی احتمالی روی هر صفحه بارگذاری شد.

جدول 1

پرایمرهای مورد استفاده در مطالعه حاضر برای تجزیه و تحلیل واکنش زنجیره ای پلیمراز بلادرنگ.

Targets Primers Annealing temperature Reference
Total bacteria F: actcctacgggaggcag
R: gactaccagggtatctaatcc
62 °C
Escherichia coli F:ggaagaagcttgcttctttgctgac
R:agcccggggatttcacatctgactta
62 °C
Clostridium cluster XIVa F: cggtacctgactaagaagc
R: agtttyattcttgcgaacg
60 °C
Faecalibacterium prausnitzii F: ggaggaagaaggtcttcgg
R: aattccgcctacctctgcact
60 °C
Bifidobacterium phosphoketolase F: atcttcggaccbgaygagac 60 °C
R: cgatvacgtgvacgaaggac

جمعیت باکتری ها با محاسبه تعداد کپی 16S rRNA یا ژن های خاص طبق روش ژو و همکاران تعیین شد. (2009).

منحنی های استاندارد با استفاده از آغازگرهای ویژه باکتری بر اساس رقت زنجیره ای از DNA پلاسمید از باکتری های دامنه، E. coli، Clostridium cluster XIVa، Faecalibacterium prausnitzii و زایلولوز-5-فسفات/فروکتوز-6-فسفات فسفوکتولاز ساخته شدند.

xfp) آمپلیکون، به ترتیب. زایلولوز-5-فسفات/فروکتوز-6-فسفات فسفوکتولاز آنزیم کلیدی مسیر F6P-فسفوکتولاز در بیفیدوباکتری ها است و به طور گسترده برای مشخص کردن بیفیدوباکتری ها استفاده شده است (Cleusix et al., 2010).

تعداد کپی ژن‌های rRNA 16S که باکتری‌های خاص را هدف قرار می‌دهند و تعداد کپی ژن xfp از طریق معادله (Ns = (Qc × C × V)/(S × W)) محاسبه شد، که در آن Ns تعداد کپی در هر گرم تازه است.

نمونه مدفوع؛ Qc عدد کپی کمی از منحنی استاندارد است. C (ng/μL) غلظت DNA نمونه است. V (μL) حجم رقت DNA جدا شده است. S (ng) مقدار DNA تجزیه و تحلیل شده است. و W (g) وزن نمونه مورد استفاده برای جداسازی DNA است.

2.5. تحلیل آماری

قبل از تجزیه و تحلیل، اندازه گیری روزانه دریافت،:

  1. عملکرد رشد و نمرات سالم به میانگین هفتگی کاهش یافت.
  2. داده های جمعیت میکروبی با استفاده از تبدیل لگاریتمی (پایه 10) برای دستیابی به توزیع نرمال تبدیل شدند.
  3. تمام داده ها با استفاده از روش PROC MIXED SAS (2002) تجزیه و تحلیل شدند.

3.نتایج

همه گوساله‌ها در شروع مطالعه سالم بودند و ایمنی منفعل را به اندازه کافی منتقل کردند.

  1. STP برای گوساله های شاهد و تیمار شده به ترتیب 0.13 ± 5.91 و 0.14 ± 5.94 گرم در دسی لیتر بود.
  2. هیچ اثر متقابلی بین درمان و زمان برای اندازه گیری در این مطالعه وجود نداشت.
  3. ارائه درمان SCB در MR، مصرف MR را تغییر نداد، که میانگین آن 7.2 L/d در طول 5 هفته اول و 4.0 L/d در هفته 6 بود.
  4. مصرف شروع کننده نیز تحت تأثیر درمان قرار نگرفت. با این حال، با افزایش سن به طور قابل توجهی افزایش یافت، به طور متوسط ​​173 گرم در روز در طول 5 هفته اول، 892 گرم در روز در هفته 6 و 2383 گرم در روز در هفته 7 و 8 (جدول 2).

جدول 2

مصرف، عملکرد رشد و امتیاز مدفوع کلاوهای تحت درمان با یا بدون مخمر پروبیوتیک (Saccharomyces cerevisiae var boulardii) در طول 8 هفته اول.

Treatment


SEM Week


SEM P value


CON Treat 1 2 3 4 5 6 7 8 Treat Week Treat × week
MR intake, L/d 6.7 6.7 0.11 5.7c 6.9b 7.8a 7.9a 7.7a 4.0d 0.13 0.96 <0.01 0.99
Starter intake, g/d 944 871 47.1 31f 103ef 179e 381d 892c 2061b 2706a 46.4 0.26 <0.01 0.87
ME intake, Mcal/d 5.6 5.4 0.13 3.9g 4.8f 5.6d 5.9c 6.3b 5.1e 5.4d 7.1a 0.14 0.36 <0.01 0.91
ADG, g/d 789 838 33.3 908ab 422d 841b 859b 649c 748bc 1040a 1044a 67.5 0.29 <0.01 0.09
ME intake: gain, Mcal/kg 8.6 7.7 0.43 4.9e 11.2a 8.5bc 7.3cd 11.0a 10.1ab 5.4de 7.0cde 0.97 0.15 <0.01 0.86
Fecal Score 0.48 0.47 0.028 1.04b 1.56a 0.82c 0.25d 0.05e 0.02e 0.04e 0.00e 0.049 0.80 <0.01 0.56
  1. MR = جایگزین شیر؛
  2. ADG = میانگین سود روزانه.
  3. ME = انرژی قابل متابولیسم؛
  4. ME جایگزین شیر و استارتر بر اساس گاوهای شیری NRC (2001) برآورد شد.
  5. a-f میانگین هفتگی با حروف بالا به طور قابل توجهی متفاوت است (P<0.05).

دریافت MR (شکل 1 الف) و دریافت شروع (شکل 1B) گوساله ها بین تیمارها مشابه بود. سریع ترین افزایش مصرف استارتر در هفته از شیر گرفتن رخ داد. هیچ تفاوتی بین تیمارها برای ADG (شکل 1C) و BW نهایی وجود نداشت که برای شاهد 88.02 ± 1.92 کیلوگرم و 87.42 ± 1.52 کیلوگرم برای درمان در هفته 8 زندگی بود (داده‌ها نشان داده نشده است).

نسبت دریافت ME: افزایش تحت تأثیر درمان قرار نگرفت (جدول 2) و به ترتیب برای کنترل و درمان به ترتیب 0.54 ± 8.64 Mcal/kg و 7.68 ± 0.42 Mcal/kg بود.

علاوه بر این، امتیاز مدفوع (شکل 1D) نیز تحت تأثیر درمان قرار نگرفت. با این حال، اثرات سنی قابل توجهی (P<0.01) برای دریافت ME، ADG، ME دریافت: افزایش و نمره مدفوع وجود داشت (جدول 2).

بالاترین مقادیر برای دریافت ME و ADG هر دو در هفته 8 (به ترتیب 7.11 Mcal/g و 1044 g/d)، در حالی که کمترین مقادیر در هفته 6 (5.09 Mcal/g) و هفته 2 (422 g/d) بود. ، به ترتیب.

  1. بالاترین دریافت: افزایش ME در هفته 2 (11.22 Mcal/kg)
  2. و کمترین آن در هفته 1 (4.89 Mcal/kg) بود
  3. بالاترین امتیاز مدفوع در هفته 2 بود (میانگین 1.56)،
  4. و مقادیر از هفته 5 سن تا پایان مطالعه نزدیک به 0 کاهش یافت.
  5. تعداد روزهایی که گوساله‌ها اسهال داشتند (امتیاز مدفوع ≥ 2) به طور میانگین 14/5 بود و بین درمان‌ها تفاوتی نداشت.
  6. علاوه بر این، نمرات بینی و گوش گوساله ها با درمان تغییر نکرد. تقریباً همه گوساله‌ها در طول کل مطالعه نمره 0 (یعنی نرمال) گرفتند (داده‌ها نشان داده نشده است)

.

جبران تغذیه آغوز گوساله

مصرف جایگزین شیر (A)، مصرف شروع (B)، میانگین افزایش روزانه (ADG; C) و نمره مدفوع (D) گوساله‌هایی که با یا بدون مخمر پروبیوتیک (Saccharomyces cerevisiae var boulardii) در طول 8 هفته اول تغذیه شدند.

  1. هیچ اثر درمانی بر روی جمعیت مدفوع کل باکتری ها، E. coli، Clostridium cluster XIVa، Faecalibacterium prausnitzii یا Bifidobacterium وجود نداشت (جدول 3).
  2. با این حال، اثرات زمانی قابل توجهی (P<0.01) برای جمعیت کل باکتری، E. coli، Clostridium cluster XIVa و Faecalibacterium prausnitzii وجود داشت.
  3. جمعیت E. coli مدفوعی با افزایش سن کاهش یافت (P<0.01) که بالاترین مقدار آن در روز 7 بود.
  4. در مقابل، جمعیت کل باکتری ها و Clostridium Cluster XIVa از روزهای 35 و 56 بیشتر از آن ها بود (P<0.01). از روز 7.
  5. علاوه بر این، جمعیت Faecalibacterium prausnitzii از روز 7 به روز 35 افزایش یافت (P<0.01) اما از روز 35 به روز 56 کاهش یافت (P<0.01).

جدول 3

جمعیت های باکتریایی هدف (تعداد کپی (log10)/g) در مدفوع گوساله های تحت درمان با یا بدون مخمر پروبیوتیک (Saccharomyces cerevisiae var boulardii) در طول 8 هفته اول.

Treatment


SEM Day


SEM P value


Control Treat 7 35 56 Treat Day Treat × Day
Total bacteria 11.99 11.85 0.101 11.48b 12.14a 12.14a 0.118 0.36 <0.01 0.30
Escherichia coli 8.45 8.48 0.120 8.99a 8.40b 8.02c 0.140 0.84 <0.01 0.19
Clostridium cluster XIVa 11.40 11.28 0.163 10.81b 11.59a 11.61a 0.220 0.6 <0.01 0.33
Faecalibacterium prausnitzii 9.78 9.80 0.120 9.09c 10.33a 9.93b 0.139 0.93 <0.01 0.99
Bifidobacterium phosphoketolase 8.75 8.69 0.145 8.77 8.62 8.78 0.177 0.77 0.78 0.59

داده ها با استفاده از تبدیل لگاریتمی (پایه 10) برای دستیابی به توزیع نرمال تبدیل شدند. a-c میانگین هفتگی با حروف بالا به طور قابل توجهی متفاوت است (P<0.05).

خلاصه پژوهشهای انجام گرفتهجهت مطالعه لطفا کلیک فرمایید

در تحقیق دیگری که توسط ، لزمایستر و همکاران انجام دادند،  گزارشها نشان میدهد  که :

  1. گنجاندن 20 گرم بر کیلوگرم کشت مخمر SC در یک غذای اولیه، مصرف DM و افزایش وزن بدن گوساله‌های جوان را بهبود خواهد بخشید،
  2. اما زمانی که دوز مکمل کشت مخمر به 1 گرم در کیلوگرم کاهش یافت، تأثیری وجود نخواهد داشت.

پژوهش انجام شده توسط گالوائو و همکاران نیز  نشان داد که:

  1. تغذیه یک SC زنده با مکمل به استارتر باعث افزایش مصرف دانه و افزایش وزن بدن گوساله ها میشود،
  2. اما زمانی که یک مخمر زنده SCB در MR گنجانده شد هیچ تاثیری وجود نداشت.

پژوهش Magalhães و همکاران. (2008) نشان داد:

  1. هیچ تفاوتی در مصرف کلی استارتر در طول دوره آزمایشی (هفته 1 تا هفته 10) بین گروه کنترل و گروه SC مشاهده نمیشود،
  2. اما یک افزایش حاشیه ای از هفته 1 تا 4 برای گوساله های تغذیه شده با محصول کشت مخمر SC وجود دارد.

پاسخ‌های متفاوت به تغذیه محصولات مخمر در مصرف و افزایش وزن بدن ممکن است به نوع محصول مخمر (مخمر زنده در مقابل کشت مخمر)، سویه مخمر، مقدار تغذیه شده به حیوان، روش تحویل مخمر (در شیر در مقابل در استارتر) مربوط باشد. و چالش بیماری موجود است.

فقدان اثر درمانی بر مدفوع گوساله‌ها غیرمنتظره بود. در گوساله‌های جوان، اگرچه امتیاز مدفوع بین تیمارها مشابه بود، Galvão و همکاران. (2005) گزارش داد که :

  1. گوساله هایی که با SCB در MR تغذیه شده بودند، روزهای کمتری با اسهال در طول پیش از شیرگیری داشتند (شاهد در مقابل SCB: 5.83 در مقابل 4.00 روز)، که با نتایج ما مطابقت نداشت.
  2. در آن مطالعه، هیچ تفاوتی در روزهای مبتلا به اسهال پس از شیرگیری (شاهد در مقابل SCB: 2.08 در مقابل 2.83 روز) بین کنترل و درمان SCB وجود نداشت.
  3. با این حال، بروز بالای اسهال مشاهده شده پس از شیرگیری، که میانگین آن 2.45 روز بود، نشان داد که گوساله‌ها هنوز تحت استرس پس از شیرگیری بودند.
  4. در مطالعه حاضر، نمرات مدفوع گوساله‌ها پس از از شیر گرفتن تقریباً صفر بود و حتی در پر استرس‌ترین هفته (یعنی هفته 2) میانگین مدفوع گوساله‌ها زیر 2 (یعنی 1.56) بود که نشان می‌دهد شدت سطح اسهال بسیار پایین بود، اگرچه روزهای اسهال تقریباً 5 روز طول کشید.

چالش نسبتاً کم بیماری گوساله ها در طول این مطالعه ممکن است تا حدی ناشی از استراتژی تغذیه کافی آغوز باشد. عموماً پذیرفته شده است که مصرف مقدار کافی آغوز با کیفیت بالا در 24 ساعت اول تولد برای گوساله‌ها برای به دست آوردن موفقیت آمیز ایمنی غیرفعال حیاتی است که با میزان مرگ و میر و عوارض گوساله‌ها رابطه معکوس دارد.

در مطالعه مگانک و همکاران، 2014). ، همه گوساله‌ها آغوز کافی دریافت کردند و غلظت STP بیش از 5.2 گرم در دسی‌لیتر داشتند که نشان‌دهنده انتقال کافی ایمنی غیرفعال در نظر گرفته می‌شود .

مدیریت خوب گوساله های از شیر گرفته شده با یک پروتکل دارویی معمولی نیز ممکن است عاملی باشد که به چالش نسبتاً کم بیماری کمک می کند. بنابراین، نتایج این مطالعه نشان می‌دهد که اثر SCB بر سلامت دستگاه گوارش گوساله‌ها زمانی که گوساله‌ها سالم و به خوبی مدیریت می‌شوند حداقل است.

مزایای تغذیه با پروبیوتیک ها در نشخوارکنندگان برای بهبود سلامت حیوانات از طریق متعادل کردن اکوسیستم میکروبی دستگاه گوارش نگرانی رو به رشدی است و مطالعات روی تأثیر پروبیوتیک های میکروبیوم روده گوساله محدود است.

از آنجایی که گزارش شده است که جامعه باکتریایی در نمونه های مدفوع گوساله های شیری می تواند ترکیب جامعه باکتریایی روده بزرگ را نشان دهد ، مطالعه حاضر 5 نشانگر میکروبی مرتبط با رشد و سلامت حیوانات در مدفوع را مقایسه کرد.

از گوساله های شاهد و تیمار شده برای ارزیابی اثر پروبیوتیک ها بر میکروبیوتای روده. از آنجایی که E. coli یکی از شایع ترین و مهم ترین علل اسهال نوزادی در گوساله های شیری است (Muktar et al., 2015)، فقدان اثر درمانی SCB بر جمعیت E. coli مدفوعی با نتایج مدفوع و نمره همخوانی داشت. نشان می دهد که :

  1. تغذیه SCB ممکن است جمعیت E. coli دستگاه گوارش را در گوساله های سالم تغییر ندهد.
  2. نتایج ما همچنین داده‌های کمی ارائه کرد که گوساله‌هایی با میانگین 108 ~ 109 نسخه ژن 16S rRNA در گرم (تا 0.3 درصد کل باکتری‌ها) جمعیت مدفوعی E. coli در روز 7 پس از تولد، علائم قابل توجهی از اسهال را نشان ندادند.
  3. علاوه بر این، فقدان تغییرات جمعیت باکتریایی مفید (به عنوان مثال، Clostridium cluster XIVa و Faecalibacterium prausnitzii و Bifidobacterium) در نمونه‌های مدفوع از گوساله‌های تیمار شده نشان می‌دهد که تغذیه SCB ممکن است تأثیری بر میکرو فلور روده نداشته باشد.

بر اساس اطلاعات ما، این اولین باری بود که اهداف میکروبی خاص کلستریدیوم، فاکالی‌باکتریوم و بیفیدوباکتریوم تحت تأثیر سن هفتگی در گوساله‌های شیری اندازه‌گیری شد. در مطالعه حاضر:

  1. کلستریدیوم در مدفوع گوساله های شیری به وفور وجود داشت
  2. جمعیت کلستریدیوم خوشه XIVa با هفتگی افزایش یافت،
  3. از 7.8 × 1010 (21.40 درصد کل باکتری ها) در روز هفتم پس از تولد به 3.9 × 3. 1011 کپی ژن در گرم (27.86٪ از کل باکتری ها) در روز 35.
  4. جمعیت Faecalibacterium prausnitzii نیز تحت تأثیر سن هفتگی قرار گرفت که از 1.2 × 109 (0.41 درصد کل باکتری ها) در روز 7 به 2.2 × 1010 ژن افزایش یافت.
  5. کپی/گرم (1.57 درصد کل باکتری ها) در روز 35. تغییرات دینامیکی جمعیت باکتریایی مدفوع گوساله های شیری در طی 8 هفته اول با مطالعه قبلی توسط Uyeno و همکاران مطابقت دارد.

دانشمندان دریافتند شاخص Chao1 به تدریج از هفته اول تا هفتم زندگی گوساله افزایش می یابد. در واقع، در طی 8 هفته اول پس از تولد، گوساله ها نه تنها تغییر سن را تجربه کردند، بلکه با تغییر رژیم غذایی از شیر به غذای جامد نیز به چالش کشیده شدند.

گزارش شده است که مصرف خوراک جامد میکروبیوم روده را در طول انتقال از شیر گرفتن تغییر می‌دهد  و تغییر میکروبیوم‌های روده تحت تأثیر خوراک جامد می‌تواند به سمت حالت نشخوارکننده بالغ باشد .

با هدف قرار دادن باکتری‌های خاص، نتایج کنونی نشان می‌دهد که جمعیت میکروبی مدفوع در گوساله‌های شیری را می‌توان تحت تأثیر هفتگی و از شیر گرفتن قرار داد، و به نظر می‌رسد تغییرات میکروبی طبیعی که در طول زمان در زندگی یک گوساله سالم رخ می‌دهد، مهم‌تر از حد انتظار باشد. اثر SCB. با این وجود، از آنجایی که در مطالعه حاضر فقط نمونه‌های مدفوع مورد آزمایش قرار گرفت، باید توجه داشت که جامعه باکتریایی روده را می‌توان برای تأیید اثرات سنی و SCB روی میکروبیوتای روده بیشتر مورد بررسی قرار داد.

مقالات آموزش تازه های تکنولوژیوبلاگ

دیدگاهتان را بنویسید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *

تماس با ما

با بیش از 37 سال سابقه درخشان در خدمت کشاورزان و دامداران محترم

تعاونی کشاورزی گاوداران اصفهان

پیام کوتاه: 9810003132673042

پست الكترونيكي:    info@ damdaranesf.com

کانال واتس آپ :  تعاونی گاوداران اصفهان

کانال آپارات: damdaranesf

اینستاگرام :damdaranesf

کدپستی دفتر مرکزی: 8158833117

کدپستی انبار: 8159355685

تعاونی کشاورزی گاوداران اصفهان






    ارائه خدمات

    جهت دریافت مشاوره رایگان در زمینه های بازرگانی ، ارائه خدمات پس از فروش، تامین نهاده ها و خوراک آماده دام و کلیه تجهیزات مورد نیاز در دامداری و همچنین رایزنی علمی ، آموزشی ، فنی و بالانس جیره و همچنین خدمات جمع آوری و آزمایشگاه و انجام آنالیز شیر لطفا با کارشناسان ما در تماس باشید . 37سال تجربه در صنعت دامپروری ، پشتوانه ما است. عزم راسخ ما در ارائه تازه های تکنولوژی نوین صنعت کشاورزی و دامپروری به اعضاء محترم شرکت تعاونی کشاورزی گاوداران اصفهان است.

    نقش حمایتی تعاونی ها در صنعت کشاورزی و دامپروری در ایران

    در حال حاضر بین 0/99 تا 1/2 درصد از تولیدات محصولات دامی جهان به کشور ایران اختصاص دارد. ایران با داشتن حدود 130 میلیون واحد دامی تجربه گرانقیمتی در صنعت دامپروری دارد بطوریکه تولیدات دامی کشور به حدود 10 میلیون تن رسیده است. تعاونی ها از عمده ترین نهادهای اقتصادی ، اجتماعی هستند که دارای توانایی های ویژه ای برای توسعه یک کشور را دارا می باشند. تشکیل شرکتهای تعاونی و حضور دامدان در فعالیتهای اقتصادی از طریق تعاونی ها با توجه به نقشهای چندگانه ای که تعاونی ها ایفا می کنند میتواند مناسبترین شیوه جلب مشارکت دامدان و رسیدن به توسعه پایدار باشد.

    مدیریت

    مدیر مالی

    داخلی 2

    حسابداری

    بازرگانی

    واحد فنی

    ارسال فکس

    داخلی 7

    کارپرداز